pFastBac- GST- C/ pFastBac- GST- C质粒/ pFastBac- GST- C Plasmid

pFastBac-GST-C

Search name

pFastBac-GST-C,Plasmid pFastBac-GST-C,pFastBac-GST-C vector

 

pFastBac-GST-C Information

Promoter: Polyhedrin

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: insect cell carrier; baculovirus expression plasmid.

Plasmid size: 5468bp

Plasmid label: N-3C, N-GST

Prokaryotic resistance: ampicillin Ampicillin

Screening markers: gentamicin Gentamicin

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: insect cells

Induction mode: constituent expression without induction

5'sequencing primers: pFastbac-F: TATTCCGGATTATTCATACC

3'sequencing primers: pFastBac-R: ACAAATGTGGTATGGCTGA

Note: the expression of GST fusion protein

Use:Insect cell plasmid

 

pFastBac-GST-C Description

The Bac-to-Bac Baculovirus Expression System provides a rapid and efficient method to generate recombinant baculoviruses (Ciccarone et al., 1997). This method was developed by researchers at Monsanto, and is based on site-specific transposition of an expression cassette into a baculovirus shuttle vector (bacmid) propagated in E. coli (Luckow et al., 1993). The major components of the Bac-to-Bac Baculovirus Expression System include:
        • A choice of pFastBac™ donor plasmids that allow generation of an expression construct containing the gene of interest where expression of the gene of interest is controlled by a baculovirus-specific promoter.
        • An E. coli host strain, DH10Bac™, that contains a baculovirus shuttle vector (bacmid) and a helper plasmid, and allows generation of a recombinant bacmid following transposition of the pFastBac™ expression construct.

 

pFastBac-GST-C Sequence