pLVX-EF1伪-IRES-mCherry/ pLVX-EF1伪-IRES-mCherry质粒/ pLVX-EF1伪-IRES-mCherry Plasmid

pLVX-EF1α-IRES-mCherry

PVT2309    2ug

 

pLVX-EF1α-IRES-mCherry Informaiton

Promoter: EF-1 alpha promoter

Replicon: pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: virus series, lentivirus cloning vector

Prokaryotic resistance: ampicillin Amp

Selection marker: red fluorescence

Clone strain: Escherichia coli Stbl3

Culture conditions: 37 C, aerobic, LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: WPRE-R:CATAGCGTAAAAGGAGCAACA

Primers for 3'sequencing: primers designed based on sequences

Remarks: there is a difference from the sequence of Clontech.

 

 

pLVX-EF1α-IRES-mCherry Description

Plvx-ef1 alpha-IRES mCherry is a bigenic lentiviral expression vector that can be used to transduce mammalian cells to produce high titers of lentiviruses, including primary and stem cells, in almost any division or non-division. The vector contains an internal ribosome entry site (IRES) that allows an interesting gene and red fluorescent protein mCherry to be simultaneously transcribed from a single mRNA expression. Transcriptionally expressed human elongation factor-1 alpha (EF-1 alpha) promoters are driven and continue to be activated even when the genome of the host cell is stably integrated into the vector. Stable transcription allows the monitoring of various cellular processes, such as primary or stem cell differentiation, not to be silenced with CMV promoters. In addition, vectors allow efficient flow cytometry to detect the expressed proteins, mCherry, and benefits of stable or transient transfection of mammalian cells without time-consuming drug and cloning options.

 

pLVX-EF1α-IRES-mCherry Sequence