pDsRed2- Mito/ pDsRed2- Mito质粒/ pDsRed2- Mito Plasmid

pDsRed2-Mito

Search name

pDsRed2-Mito,Plasmid pDsRed2-Mito,pDsRed2-Mito vector

 

 

pDsRed2-Mito Information

Promoter: CMV promoter

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation serial plasmids; lactating fluorescent plasmids; lactating red plasmids

Plasmid size: 4715bp

Plasmid label: N-DsRed2

Prokaryotic resistance: kanamycin Kan (50 mu g/ml)

Screening markers: neomycin Neo/G418

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG)

3'sequencing primers: SV40-polyA-R (GAAATTTGTGATGCTATTGC)

Remarks: the red fluorescent localization plasmid of mammalian mitochondria

 

pDsRed2-Mito Description

PDsRed2-Mito is a mitochondrial localization plasmid of mammalian cells, which contains the mitochondrial targeting sequence of the codon optimized red fluorescent protein gene DsRed2 and human cytochrome c oxidase (Mito) subunit VIII.

pDsRed2-Mito is a mammalian expression vector that encodes a fusion of Discosoma sp. Red fluorescent protein (DsRed2; 1, 2) and the mitochondrial targeting sequence from subunit VIII of human cytochrome c oxidase (Mito; 3, 4). The Mito sequence is fused to the 5'-end of DsRed2, a human codon-optimized DsRed variant that is engineered for faster maturation and lower nonspecific aggregation (1, 5). The Mito sequence targets the Mito-DsRed2 fusion protein to the host cell’s mitochondria. To drive expression of Mito-DsRed2, this vector contains the immmediate early promoter of cytomegalovirus (PCMV IE ). SV40 polyadenylation signals downstream of the DsRed2 gene direct proper processing of the 3'-end of the Mito-DsRed2 mRNA. This vector also contains an SV40 origin for replication in any mammalian cell line that expresses the SV40 T-antigen, a pUC origin of replication for propagation in E. coli, and an f1 origin for single-stranded DNA production. A neomycin resistance cassette—consisting of the SV40 early promoter (PSV40e), the neomycin/kanamycin resistance gene of Tn5 (Neor/Kanr), and polyadenylation signals from the herpes simplex virus thymidine kinase (HSV TK poly A) gene—allow stably transfected eukaryotic cells to be selected using G418 (6). A bacterial promoter (P) upstream of this cassette drives expression of the gene encoding kanamycin resistance in E. coli. pDsRed2-Mito is designed for fluorescent labeling of mitochondria. The vector can be introduced into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 (6). The Mito-DsRed2 fusion (excitation/emission maxima: 558 nm/583 nm) can be detected by fluorescence microscopy and by flow cytometry. Filter sets optimized for detecting DsRed by microscopy are available from Chroma Technology Corporation and Omega Optical Inc. Please see their websites (www.chroma.com and www.omegafilters.com) and the Living Colors® Vol. II User Manual, provided with this vector, for more information. To detect MitoDsRed2-expressing cells by flow cytometry, use the instrument’s argon-ion laser to excite the fluorophore at 488 nm and the FL-2 channel to detect the fluorophore’s emission at 583 nm.

 

pDsRed2-Mito Sequence