pEYFP- Actin/ pEYFP- Actin质粒/ pEYFP- Actin Plasmid

pEYFP-Actin

Search name

pEYFP-Actin,Plasmid pEYFP-Actin,pEYFP-Actin vector

 

pEYFP-Actin information

Promoter: CMV
Replicator: pUC ori, F1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: mammalian cells, fluorescent protein reporting carriers
Plasmid size: 5820bp
Prokaryotic resistance: Kan
Screening markers: Neo
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, instantaneous expression
5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG
3'sequencing primers: primers designed according to sequence

 

pEYFP-Actin Description

pEYFP-Actin encodes a fusion of the enhanced yellow fluorescent protein (EYFP) and human cytoplasmic β-actin. EYFP is an enhanced yellow-green variant of the Aequorea victoria green fluorescent protein (GFP). The EYFP gene contains the four amino acid substitutions previously published as GFP-10C: Ser-65 to Gly; Val-68 to Leu; Ser-72 to Ala; and Thr-203 to Tyr. It also contains the Phe-64 to Leu mutation of GFPmut1. The fluorescence excitation maximum of EYFP is 513 nm; the emission spectrum has a peak at 527 nm (in the yellow-green region). When excited at 513 nm, the Em of EYFP is 36,500 cm–1M–1 and the fluorescence quantum yield is 0.63, resulting in a bright fluorescent signal. The fluorescence observed is roughly equivalent to that from EGFP

 

pEYFP-Actin Sequence